| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.081333 |
| Chromosome: | chromosome 12 |
| Location: | 4130758 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518100 | FAL16 | Chlamydomonas-specific family protein; (1 of 44) IPR000595 - Cyclic nucleotide-binding domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAAACAAACACTCTCGCACCTGTTCACAA |
| Internal bar code: | GCCGGAGGCGCTCAGGACGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 171 |
| LEAP-Seq percent confirming: | 95.5036 |
| LEAP-Seq n confirming: | 531 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCTAGGGTGACCCGACCT |
| Suggested primer 2: | TTCTAGAACCTTCCGCCTCA |