Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.081334 |
Chromosome: | chromosome 3 |
Location: | 9089535 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g211073 | (1 of 2) K14497 - protein phosphatase 2C (PP2C) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAACGCCGCCACCGCCACCCCTGACCGC |
Internal bar code: | GCCGTGGGGCGAGGATCGAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 321 |
LEAP-Seq percent confirming: | 99.5911 |
LEAP-Seq n confirming: | 4628 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGGTCAAGAGACCTCAGC |
Suggested primer 2: | AGCGGTCGTATGGTAAGGTG |