| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.081372 |
| Chromosome: | chromosome 3 |
| Location: | 1145734 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g149250 | ICL2 | Isocitrate lyase; (1 of 1) 4.1.3.32 - 2,3-dimethylmalate lyase / (2R,3S)-2,3-dimethylmalate pyruvate-lyase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTCTGAACGGGCGGCATTCGCGTGCGCA |
| Internal bar code: | ACGCGAGAACAAGGGGAGTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 157 |
| LEAP-Seq percent confirming: | 17.0945 |
| LEAP-Seq n confirming: | 646 |
| LEAP-Seq n nonconfirming: | 3133 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTAGTCCTGCAAGGGGGAT |
| Suggested primer 2: | ATCTGCAAGGCTGTGTGTTG |