| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.081449 |
| Chromosome: | chromosome 10 |
| Location: | 625008 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g421950 | TEF26 | (1 of 4) PF12576 - Protein of unknown function (DUF3754) (DUF3754); Predicted protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGACGTCGGTAAAGTCAGTCGCTTCGGCT |
| Internal bar code: | GTTGGTTCGCTAAACACGGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 676 |
| LEAP-Seq percent confirming: | 93.3775 |
| LEAP-Seq n confirming: | 282 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCAACCGCCACAACATAG |
| Suggested primer 2: | CTGCCTTACCACTGTCCCAT |