| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.081525 |
| Chromosome: | chromosome 13 |
| Location: | 3119771 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g584901 | MKS3,TMEM67 | Transmembrane protein 67; (1 of 1) K19348 - meckelin (TMEM67, MKS3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTCCCGCCCCCCACCTGCAGTTGTAGG |
| Internal bar code: | GGTTTGAATATAGGGGTTCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 207 |
| LEAP-Seq percent confirming: | 98.659 |
| LEAP-Seq n confirming: | 515 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCTTTGAACCAACCCCTT |
| Suggested primer 2: | GTCGGGTTCTCCATGAGTGT |