| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.081550 |
| Chromosome: | scaffold 36 |
| Location: | 11718 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre36.g759647 | (1 of 4) 3.1.3.24 - Sucrose-phosphate phosphatase / Sucrose-6-phosphate phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCAGGCTGAGGGCACGCATGGCAACCAT |
| Internal bar code: | ATACGTCTATCGCTAGCTTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 115 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTGTTTGTCTGTGTGGGG |
| Suggested primer 2: | CAAGTGGAAACCTGCCGTAT |