| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.081600 |
| Chromosome: | chromosome 4 |
| Location: | 3553127 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g228350 | DLA4 | (1 of 1) 2.3.1.168 - Dihydrolipoyllysine-residue (2-methylpropanoyl)transferase / Dihydrolipoyl transacylase; Dihydrolipoamide acetyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAACCCACCCACACTGCCTTACCGCAGCG |
| Internal bar code: | CCGCTGTCTGCTCCGCATCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 698 |
| LEAP-Seq percent confirming: | 99.1699 |
| LEAP-Seq n confirming: | 2270 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTGTCGCAAACTGTCTT |
| Suggested primer 2: | ACCCCATGGTCTCCTCTCTT |