| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.081762 |
| Chromosome: | chromosome 4 |
| Location: | 3910664 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g230732 | CSR2 | Carbohydrate sulfotransferase-related 2; (1 of 3) K08106 - N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase (CHST15) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGTGGGTTTGCAGAGGCGGGAGACATA |
| Internal bar code: | GGGGGTCCGCCTAGCAAGGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 182 |
| LEAP-Seq percent confirming: | 95.3368 |
| LEAP-Seq n confirming: | 736 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAATCAGGTGCAGACAGAA |
| Suggested primer 2: | TTGTGCTGCGAACCTTACAC |