| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.081810 |
| Chromosome: | chromosome 14 |
| Location: | 3705026 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g631900 | (1 of 1) K14648 - poly(U)-specific endoribonuclease (ENDOU, PP11); Similar to Putative Serine Protease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGGTGCGATGCGGTGCGGGCGCCTCAGC |
| Internal bar code: | TCTACTCAGCAACCCGATGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 424 |
| LEAP-Seq percent confirming: | 99.1551 |
| LEAP-Seq n confirming: | 4225 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCCAGACCCAAACCAGAC |
| Suggested primer 2: | CGTTGGTGTATGTACGACGC |