| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.081947 |
| Chromosome: | chromosome 2 |
| Location: | 1126787 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g081400 | BCA1 | Branched chain amino acid aminotransferase; (1 of 1) 2.6.1.88 - Methionine transaminase / Methionine-oxo-acid transaminase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTGGCAGCGCATTGGCAAGGCACGACTT |
| Internal bar code: | CCCGACATCGCGTATATCCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 66 |
| LEAP-Seq percent confirming: | 98.2222 |
| LEAP-Seq n confirming: | 442 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGGAGTAATGGGAATGGG |
| Suggested primer 2: | AGCCTTTCCAACTGCTCAAA |