| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.082115 |
| Chromosome: | chromosome 4 |
| Location: | 1458078 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214050 | SULTR4,SUL4,MOT1 | (1 of 1) PTHR31970:SF0 - MOLYBDATE TRANSPORTER 2; Molybdate transporter, type 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCACGGGGTCCGCACTGCGCCTGGGCCG |
| Internal bar code: | ACGGAAGGGCTAGGGTGCGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 726 |
| LEAP-Seq percent confirming: | 98.547 |
| LEAP-Seq n confirming: | 1153 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCTGCACAACCACACTGC |
| Suggested primer 2: | AGAATCGTGGGTTGGAAGTG |