| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.082137 |
| Chromosome: | chromosome 10 |
| Location: | 5319566 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g457750 | SULTR1 | (1 of 2) K18059 - sulfate transporter 4 (SULTR4); Sulfate transporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGCTTGTTCACCTGTAGCGTGCGAGGG |
| Internal bar code: | ACGCAAAGGGATCGGTCGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 260 |
| LEAP-Seq percent confirming: | 50.8133 |
| LEAP-Seq n confirming: | 656 |
| LEAP-Seq n nonconfirming: | 635 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACAGTGGCAGACAAGC |
| Suggested primer 2: | AGACGTCCCCACAAGTTACG |