Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.082158 |
Chromosome: | chromosome 11 |
Location: | 2773389 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g477300 | PPP36,FAP8 | Flagellar Associated Protein 8; (1 of 1) K03456 - serine/threonine-protein phosphatase 2A regulatory subunit A (PPP2R1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCACGTATCTTTGGCGTTTTGCCTTGTG |
Internal bar code: | TAGCGAGATCTCGCGCGACTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1173 |
LEAP-Seq percent confirming: | 99.688 |
LEAP-Seq n confirming: | 12461 |
LEAP-Seq n nonconfirming: | 39 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCAATACGGCAACTGTGG |
Suggested primer 2: | ACGCTGACGACAACAATGAG |