| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.082254 |
| Chromosome: | chromosome 16 |
| Location: | 6075640 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g676050 | ARP3 | (1 of 1) K18584 - actin-related protein 3 (ACTR3, ARP3); Actin-related protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGAAGGCCTGGCGTGCATGTACCGTACA |
| Internal bar code: | TCGCCACAGAGGACGAGAGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 626 |
| LEAP-Seq percent confirming: | 99.0351 |
| LEAP-Seq n confirming: | 2258 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGAAATAGGGGGAGGTGG |
| Suggested primer 2: | GCTCTTTAAGTTGCCGATGC |