Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.082254 |
Chromosome: | chromosome 16 |
Location: | 6075644 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676050 | ARP3 | (1 of 1) K18584 - actin-related protein 3 (ACTR3, ARP3); Actin-related protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGCGTGCACACTCACACTCAAACGCGCG |
Internal bar code: | ATCATCTTTAACTGCCAGTGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 411 |
LEAP-Seq percent confirming: | 99.8584 |
LEAP-Seq n confirming: | 2115 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATGAAATAGGGGGAGGTGG |
Suggested primer 2: | GCTCTTTAAGTTGCCGATGC |