Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.082274 |
Chromosome: | chromosome 13 |
Location: | 3904543 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g590500 | FAD6,DES6 | (1 of 1) K10255 - omega-6 fatty acid desaturase (delta-12 desaturase) (FAD6, desA); Omega-6-fatty acid desaturase, chloroplast isoform | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGGGACACTCACCGGACGCGCGCTGGGC |
Internal bar code: | TGTCGGAGCAAAGTTTGGGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 277 |
LEAP-Seq percent confirming: | 63.4897 |
LEAP-Seq n confirming: | 1692 |
LEAP-Seq n nonconfirming: | 973 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTTGTTGGATTGGTCTGC |
Suggested primer 2: | TCCACCTAGGCCTCATCATC |