| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.082327 |
| Chromosome: | chromosome 12 |
| Location: | 3400506 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g496950 | (1 of 1) 3.4.13.5 - Xaa-methyl-His dipeptidase / X-methyl-His dipeptidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGCGTCATCCCCAAGGCGGCGCAGGGC |
| Internal bar code: | TGTGGCTCGTCTTACATTTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 750 |
| LEAP-Seq percent confirming: | 99.8205 |
| LEAP-Seq n confirming: | 21689 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATGAGGGCGTGTGGATAG |
| Suggested primer 2: | CCCTACCTTGCCAATCAAGA |