Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.082344 |
Chromosome: | chromosome 11 |
Location: | 2623072 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g476376 | FAP221,Pcdp1,RPC82 | Flagellar Associated Protein 221; (1 of 1) PTHR23053//PTHR23053:SF21 - DLEC1 DELETED IN LUNG AND ESOPHAGEAL CANCER 1 // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTCCACGTCCAGGCTGCCGTACGGGCTG |
Internal bar code: | GGTGAGGGCCTAGGTTCCAAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 453 |
LEAP-Seq percent confirming: | 99.0909 |
LEAP-Seq n confirming: | 7848 |
LEAP-Seq n nonconfirming: | 72 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCGGTAAAGGAGGGGTTT |
Suggested primer 2: | ATACCAGCCCAAACTGAACG |