| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.082395 |
| Chromosome: | chromosome 2 |
| Location: | 3860863 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095900 | ROC114,ROC108 | Rhythm Of Chloroplast 114; (1 of 13) PF00646 - F-box domain (F-box) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGCCCCCAGAGCTGCTGCTGGTCGTCG |
| Internal bar code: | TACCGCCAAGACGGGCATCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1155 |
| LEAP-Seq percent confirming: | 98.7792 |
| LEAP-Seq n confirming: | 5664 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATAAGCTCGCACAACAGG |
| Suggested primer 2: | CCTTCATCGCCCATATCAGT |