Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.082395 |
Chromosome: | chromosome 12 |
Location: | 7651595 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g554650 | REC8 | cohesin complex subunit, putative meiotic isoform; (1 of 3) PF04824 - Conserved region of Rad21 / Rec8 like protein (Rad21_Rec8) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCAGGAAGACAGGGGAGGGCTCAACCCA |
Internal bar code: | GCTACGGTGACTTGGAAGCACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 466 |
LEAP-Seq percent confirming: | 99.0959 |
LEAP-Seq n confirming: | 5042 |
LEAP-Seq n nonconfirming: | 46 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTGCCAGCATCTCAAACAC |
Suggested primer 2: | TTCGTGATCACTTCCTGCTG |