Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.082503 |
Chromosome: | chromosome 1 |
Location: | 349287 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g002200 | RPB6 | Subunit of DNA-directed RNA polymerase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGAAGGGCACCTTCTTCTCGCGCAGCT |
Internal bar code: | CATACTCGGCCCGCGCGGTTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 105 |
LEAP-Seq percent confirming: | 11.3384 |
LEAP-Seq n confirming: | 848 |
LEAP-Seq n nonconfirming: | 6631 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGATGGCCCAGTCCTCATA |
Suggested primer 2: | GTATTAGGGACACGCGCATT |