| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.082598 |
| Chromosome: | chromosome 7 |
| Location: | 1193007 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g321000 | CYG14 | (1 of 1) PF00211//PF01590 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // GAF domain (GAF); Adenylate/guanylate cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAACTGGGTGTCACCGTCATCGTCTGC |
| Internal bar code: | AAAGTGTAGCTCATTCTTCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 292 |
| LEAP-Seq percent confirming: | 99.4478 |
| LEAP-Seq n confirming: | 3602 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGCCTGCAAACAAAAGAG |
| Suggested primer 2: | GCAAGTGGTGTCAGCTTTGA |