| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.082656 |
| Chromosome: | chromosome 14 |
| Location: | 3139443 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g628800 | (1 of 1) 3.4.21.112 - Site-1 protease / Subtilisin/kexin isozyme 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCAAACTACACCGAAGCCAATGCAAAAG |
| Internal bar code: | GCTTAGTTCCAGGCTACTTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 577 |
| LEAP-Seq percent confirming: | 98.4643 |
| LEAP-Seq n confirming: | 1090 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGCGGTTTGTGTTAGACC |
| Suggested primer 2: | CCAGCCCAAACTTAACCAAA |