| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.082674 |
| Chromosome: | chromosome 16 |
| Location: | 2470588 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g660750 | MKS6,CC2D2A | (1 of 1) K19352 - coiled-coil and C2 domain-containing protein 2A (CC2D2A); Coiled-coil and C2 domain containing 2A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATTACGCATAGCGGCAGCGAGCGCATG |
| Internal bar code: | CCCGTCAATTGACCGCTGTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 320 |
| LEAP-Seq percent confirming: | 99.2252 |
| LEAP-Seq n confirming: | 1793 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCTGTGCTCTATAGGCCG |
| Suggested primer 2: | GTCGTGCATGTTACGACAGC |