| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.082677 |
| Chromosome: | chromosome 7 |
| Location: | 5796971 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g353200 | (1 of 1) IPR006073//IPR016496//IPR025121//IPR027417//IPR030394 - GTP binding domain // GTPase HflX // GTPase HflX, N-terminal // P-loop containing nucleoside triphosphate hydrolase // HflX-type guanine nucleotide-binding (G) domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCCGCAGGCCGTGTGCAGGTACCGGTGT |
| Internal bar code: | ACGTCGTAGGCACCGCTGCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 322 |
| LEAP-Seq percent confirming: | 63.5209 |
| LEAP-Seq n confirming: | 3150 |
| LEAP-Seq n nonconfirming: | 1809 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGTTGTCGTCATCAGTCG |
| Suggested primer 2: | CTTTCCTTGTGCTTTCCTGC |