| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.082986 |
| Chromosome: | chromosome 12 |
| Location: | 4439817 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521250 | PPE1 | Putative mitochondrial ribosomal protein, Ppe1 homolog; (1 of 1) 3.1.1.89 - Protein phosphatase methylesterase-1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGACAGACAATGACACGGACTTTTCAAA |
| Internal bar code: | GGTGGTCACGAGAGGCAATATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 139 |
| LEAP-Seq percent confirming: | 99.1667 |
| LEAP-Seq n confirming: | 476 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCGGAATTCGAGACACT |
| Suggested primer 2: | AAGTGGTTCACAGTTGCACG |