Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.083050 |
Chromosome: | chromosome 16 |
Location: | 6804976 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g674739 | (1 of 1) PF12537 - The Golgi pH Regulator (GPHR) Family N-terminal (GPHR_N) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAAGTAAGAGCTTGGCCTAAAGTGGAG |
Internal bar code: | CGGCGGCAGGGGCGCGCTCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 555 |
LEAP-Seq percent confirming: | 98.8525 |
LEAP-Seq n confirming: | 1206 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATAAGGGTTGCGCATGAGT |
Suggested primer 2: | CCCATTCAGTTCAGTTCGGT |