Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.083104 |
Chromosome: | chromosome 6 |
Location: | 5969665 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g288950 | (1 of 33) IPR013763 - Cyclin-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGAAGCGCAGCCAGCCATGACACCTACAC |
Internal bar code: | TAATGCCCCCGACGAGTCGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 543 |
LEAP-Seq percent confirming: | 99.8401 |
LEAP-Seq n confirming: | 1249 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACATCAATTGTTGCAGCC |
Suggested primer 2: | TGCAATCGCATGTACCGTAT |