Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.083182 |
Chromosome: | chromosome 3 |
Location: | 6455966 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g194700 | AGL1 | (1 of 1) 3.2.1.20//3.2.1.3 - Alpha-glucosidase / Maltase-glucoamylase // Glucan 1,4-alpha-glucosidase / Lysosomal alpha-glucosidase; Alpha glucosidase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCTTGATGAGTTGCTGCTGACCGTGAA |
Internal bar code: | TCGATGACGCAGTCTAGGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 302 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTGGCGTAGTTTCACAGA |
Suggested primer 2: | TACGGCTACGCAGACTCCTT |