| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.083199 |
| Chromosome: | chromosome 13 |
| Location: | 1034524 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g568600 | IPP9 | Multiple inositol-polyphosphate phosphatase; (1 of 1) 3.1.3.62//3.1.3.8 - Multiple inositol-polyphosphate phosphatase / MIPP // 3-phytase / Phytate 6-phosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACACCAGGATCCGCAAGGCTCGCAGTG |
| Internal bar code: | CTTGGGTCCGTCGTCACTTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 273 |
| LEAP-Seq percent confirming: | 99.4727 |
| LEAP-Seq n confirming: | 2641 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCACCTGAAAGGCTAACGC |
| Suggested primer 2: | GGGTGATGGTAAAGTGGTGG |