| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.083234 |
| Chromosome: | chromosome 16 |
| Location: | 109986 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g695450 | SPL11,UAF4 | U2 snRNP auxiliary factor, large subunit; (1 of 1) PTHR23139:SF68 - ZINC FINGER CCHC-TYPE AND RNA-BINDING MOTIF-CONTAINING PROTEIN 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGGTGGACGGCATGCTGAGCGAGGACC |
| Internal bar code: | AATGGAACGCACGACGACAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 385 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGGCGTGTATGTGTGACC |
| Suggested primer 2: | CCATCGGGCAACTACAACTT |