| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.083264 |
| Chromosome: | chromosome 7 |
| Location: | 573571 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g316600 | MKP5 | (1 of 3) K04459 - dual specificity MAP kinase phosphatase (DUSP, MKP); Dual-specificity protein phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCCATCGGCCTGTGTCTCTCTTACTTT |
| Internal bar code: | CCCACCATGTTCTCTTTGTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 482 |
| LEAP-Seq percent confirming: | 99.1304 |
| LEAP-Seq n confirming: | 342 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACGTGATAAGGGAGACG |
| Suggested primer 2: | ACTGGTGTTCGATGTGGTGA |