| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.083303 |
| Chromosome: | chromosome 3 |
| Location: | 2118892 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g157000 | ELG1 | Exostosin-like glycosyltransferase 1; (1 of 1) PF12661 - Human growth factor-like EGF (hEGF) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAGCGTGACAGACCAAGCATGATGGCCA |
| Internal bar code: | GTGGACGGATGGGATGCAGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 95 |
| LEAP-Seq percent confirming: | 96.4912 |
| LEAP-Seq n confirming: | 110 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAATCGTCCTGTGCTTCT |
| Suggested primer 2: | ACCACGTTTGACGGTCTGTT |