| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.083315 |
| Chromosome: | chromosome 6 |
| Location: | 2681819 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g270250 | CDC45,DIV65 | (1 of 1) K06628 - cell division control protein 45 (CDC45); Cell Division Cycle protein 45 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCCGCGATGTGCGAACTGTAACGTGCT |
| Internal bar code: | CGTGTTGTCATGTGAAGGCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 487 |
| LEAP-Seq percent confirming: | 99.4475 |
| LEAP-Seq n confirming: | 720 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTAACGAAAGCTTGATGGGG |
| Suggested primer 2: | TGCAACCCTACTCACTGCAC |