| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.083402 |
| Chromosome: | chromosome 9 |
| Location: | 7752759 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g416250 | MYO2 | Myosin heavy chain, class VIII; (1 of 3) K10357 - myosin V (MYO5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTAAGAGACGCCCTTATCTCGCACTGCA |
| Internal bar code: | ATATCGCGGTAGACCAACGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 169 |
| LEAP-Seq percent confirming: | 97.7352 |
| LEAP-Seq n confirming: | 561 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAGCAGCTTGATGACCAC |
| Suggested primer 2: | CCAAGAAGGCGATGCAGTAT |