| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.083536 |
| Chromosome: | chromosome 10 |
| Location: | 5663103 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g460532 | APC2 | (1 of 1) K03349 - anaphase-promoting complex subunit 2 (APC2); Anaphase promoting complex subunit 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCCCACCACCTCTACCCGCCCACTTCC |
| Internal bar code: | GAGTGCTGCGGAGGGCTTGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 99 |
| LEAP-Seq percent confirming: | 98.9247 |
| LEAP-Seq n confirming: | 276 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAGGGGCACATGAGAACA |
| Suggested primer 2: | TCGTGTCCCGTTGTGTTAAA |