| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.083539 |
| Chromosome: | chromosome 17 |
| Location: | 5633564 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g738150 | ERM10 | (1 of 13) PTHR13018//PTHR13018:SF5 - PROBABLE MEMBRANE PROTEIN DUF221-RELATED // PHOSPHATE METABOLISM PROTEIN 7; ERD4-related membrane protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGATGGAGAGCAGCAGCAGCGCACCCAGC |
| Internal bar code: | TCTGGCTACGTCCCCGCTGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 479 |
| LEAP-Seq percent confirming: | 81.9058 |
| LEAP-Seq n confirming: | 1444 |
| LEAP-Seq n nonconfirming: | 319 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTCTGCAATACACACGGA |
| Suggested primer 2: | CCTAACGCAGTCTCGACCTC |