| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.083628 |
| Chromosome: | chromosome 1 |
| Location: | 2635623 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g015350 | POR1,POR | Light-dependent protochlorophyllide reductase; (1 of 1) K00218 - protochlorophyllide reductase (E1.3.1.33, por) | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATACTTCTTATGGCATTGGTCAAGGAA |
| Internal bar code: | ATGAAGTTGTAGGGCACTTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 75 |
| LEAP-Seq percent confirming: | 85.5556 |
| LEAP-Seq n confirming: | 77 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCAGTAAGTTCGCTTGG |
| Suggested primer 2: | GAGGCCTTGAAGTTCTGCAC |