| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.083638 |
| Chromosome: | chromosome 10 |
| Location: | 6457367 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g466200 | CYCAB1 | A/B-type cyclin; (1 of 3) K06627 - cyclin A (CCNA) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAGGGAGGGAGGGAGGGAGGGAGAGGTT |
| Internal bar code: | GGCCCTCATGGGTCTTCTGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 60 |
| LEAP-Seq percent confirming: | 76.1905 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGACGTGTCGTTCACTCTC |
| Suggested primer 2: | AAACTCCACCTCGTGATCCA |