| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.083652 |
| Chromosome: | chromosome 7 |
| Location: | 3869091 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g338900 | (1 of 1) PTHR12072//PTHR12072:SF4 - CWF19, CELL CYCLE CONTROL PROTEIN // CWF19-LIKE PROTEIN 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGGTGTACCTGGCGCTGGACAAGGGCCA |
| Internal bar code: | CTGCTGCCTCATGTGGGACGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 174 |
| LEAP-Seq percent confirming: | 98.1168 |
| LEAP-Seq n confirming: | 521 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGTCTCCGTGTGCTCTCA |
| Suggested primer 2: | TGCTCAGGTGGATGCTAGTG |