| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.083700 |
| Chromosome: | chromosome 3 |
| Location: | 4193745 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174000 | EFG11,LPA2 | Mitochondrial translation elongation factor EFG/EF2, LepA-related; (1 of 1) PTHR23115:SF97 - TRANSLATION FACTOR GUF1, MITOCHONDRIAL | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCTGGTCTTCATGAGCTCGGGGAACAGC |
| Internal bar code: | CAAGGGAGTCTTCCGCGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 260 |
| LEAP-Seq percent confirming: | 63.3762 |
| LEAP-Seq n confirming: | 1528 |
| LEAP-Seq n nonconfirming: | 883 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCATAACAACCTTGGCCC |
| Suggested primer 2: | CTCGTTCGACTACGAGGAGG |