Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.083700 |
Chromosome: | chromosome 9 |
Location: | 4097033 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g393580 | (1 of 2) PF03097 - BRO1-like domain (BRO1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTGCTCGACACAGCCAATGCTATCCC |
Internal bar code: | TTTACGTGTGCCCGTTGACGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 66 |
LEAP-Seq percent confirming: | 89.6018 |
LEAP-Seq n confirming: | 405 |
LEAP-Seq n nonconfirming: | 47 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCAAGCCCCAGAAATCAAC |
Suggested primer 2: | ATGTCTGTATGCCCACGTCA |