| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.083734 |
| Chromosome: | chromosome 9 |
| Location: | 7179023 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g412150 | PPR11 | (1 of 12) IPR002885 - Pentatricopeptide repeat; PentatricoPeptide Repeat protein 11 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTTCCACGGCACTGGATTGTGAACTGGG |
| Internal bar code: | TCGACTGTCAGCCAAGTACAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 358 |
| LEAP-Seq percent confirming: | 94.9272 |
| LEAP-Seq n confirming: | 8346 |
| LEAP-Seq n nonconfirming: | 446 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGCACACACACACACAC |
| Suggested primer 2: | TGCATGTAAGGCTATGCAGC |