| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.083745 |
| Chromosome: | chromosome 16 |
| Location: | 887282 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648200 | CYP744C1,CYP35 | (1 of 3) K01832 - thromboxane-A synthase (TBXAS1, CYP5A); Cytochrome P450, CYP3 superfamily | CDS|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCTGCAGCGTCACCCACACGCCGTCCG |
| Internal bar code: | GCCTGGGTTGCCGTACCACTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 141 |
| LEAP-Seq percent confirming: | 99.0752 |
| LEAP-Seq n confirming: | 1607 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTTGCTAGTGAATGCGA |
| Suggested primer 2: | GCACTTTTGCCATGGGTACT |