| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.083798 |
| Chromosome: | chromosome 4 |
| Location: | 1353598 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214501 | PNP1,PNT2 | Chloroplast polyribonucleotide phosphorylase; (1 of 1) 2.7.7.8 - Polyribonucleotide nucleotidyltransferase / Polynucleotide phosphorylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCGCCTCGACTCACACGCACGCCGCAAG |
| Internal bar code: | ACGTGGCGCTCGTATTGGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 93 |
| LEAP-Seq percent confirming: | 9.81292 |
| LEAP-Seq n confirming: | 278 |
| LEAP-Seq n nonconfirming: | 2555 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGACTCGTCACAAACTGCC |
| Suggested primer 2: | TGGTTCAGAGAAGTGTTGCG |