Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.083842 |
Chromosome: | chromosome 10 |
Location: | 4670515 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g453350 | (1 of 1) PF00097//PF04536 - Zinc finger, C3HC4 type (RING finger) (zf-C3HC4) // TLP18.3, Psb32 and MOLO-1 founding proteins of phosphatase (TPM) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGATGCATGCGGCTGTGTGGCGGGCGCG |
Internal bar code: | TTCAGGAACCGAGTTAGCCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 139 |
LEAP-Seq percent confirming: | 99.6606 |
LEAP-Seq n confirming: | 881 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTCCTCTTGTTTGCTGCTC |
Suggested primer 2: | CATGAACGAGGAGATGCTCA |