| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.083901 |
| Chromosome: | chromosome 3 |
| Location: | 5304082 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g183700 | BGS1,GSL3,GTR10 | Glucan synthase-like 3; (1 of 4) K00706 - 1,3-beta-glucan synthase (E2.4.1.34) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCATGCGTGCGCCCCTCCAGCTGCCCAGT |
| Internal bar code: | CGCCCTTAAATTTTAATTCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 53 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATACAACGTGAGCGGAGTG |
| Suggested primer 2: | AAAAACACCCTGTGCCAGAC |