| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.083964 |
| Chromosome: | chromosome 11 |
| Location: | 3321596 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g480250 | (1 of 22) PF01764 - Lipase (class 3) (Lipase_3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATGAGCCGCCTACGAAAACCACACCAA |
| Internal bar code: | GCCGTCCCCGGGCGGGTCACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 830 |
| LEAP-Seq percent confirming: | 99.5287 |
| LEAP-Seq n confirming: | 1056 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGGATTACGTGGTATGAA |
| Suggested primer 2: | TGATTCATTCGGACGTGTGT |