Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.084077 |
Chromosome: | chromosome 13 |
Location: | 1659148 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g573950 | ZRT3,CrZIP3 | (1 of 6) K14709 - solute carrier family 39 (zinc transporter), member 1/2/3 (SLC39A1_2_3, ZIP1_2_3); Zinc-nutrition responsive transporter | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGTGGCACTGATGGTGTTCCTGGAGC |
Internal bar code: | GAGATCACGTGGGGATAGCTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 541 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 176 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTACAACGAGCCGGACATT |
Suggested primer 2: | TCGCAGCAATGTTTGAACTC |