| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.084083 |
| Chromosome: | chromosome 3 |
| Location: | 3292264 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g166050 | SBD1 | Selenium binding protein; (1 of 1) PTHR23300:SF0 - SELENIUM-BINDING PROTEIN 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGGGGGATGGGGGCTGCCGTGTGTGTC |
| Internal bar code: | AATTGGGAATCTATTTAGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 473 |
| LEAP-Seq percent confirming: | 99.5807 |
| LEAP-Seq n confirming: | 475 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAACCTCCAAATCCATCCGA |
| Suggested primer 2: | CGGGTTGTGCTAGGTTTGTT |